View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1834_low_29 (Length: 209)
Name: NF1834_low_29
Description: NF1834
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1834_low_29 |
 |  |
|
| [»] chr5 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 186; Significance: 1e-101; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 186; E-Value: 1e-101
Query Start/End: Original strand, 1 - 209
Target Start/End: Original strand, 23141881 - 23142092
Alignment:
| Q |
1 |
tgagatgaaggaagaatattccaaaaatgatttcacatatatgattaggattttgcatgttaataatctgaaacatataaataataaacatgtgctttgc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| ||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23141881 |
tgagatgaaggaagaatattccaaaaatgatttcacatatatgattagaattttacatgttaataatctgaaacatataaataataaacatgtgctttgc |
23141980 |
T |
 |
| Q |
101 |
caaccatattattgttggtgctgttcttccttgtcctatgggacgaaatttcccaagaatcacatttctaatttaa---aacatgtgctttctgaaagtg |
197 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
23141981 |
caaccatattattgttggtgctgttcttccttgtcctatgggacgaaatttcccaagcatcacatttctaatttaaaacaacatgtgctttctgaaagtg |
23142080 |
T |
 |
| Q |
198 |
tgtttctcagat |
209 |
Q |
| |
|
|||||||||||| |
|
|
| T |
23142081 |
tgtttctcagat |
23142092 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University