View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1834_low_6 (Length: 374)
Name: NF1834_low_6
Description: NF1834
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1834_low_6 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 341; Significance: 0; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 341; E-Value: 0
Query Start/End: Original strand, 19 - 367
Target Start/End: Complemental strand, 6388148 - 6387800
Alignment:
| Q |
19 |
tgatatatatagatataaacttttcttccttagaaactaaattgaatgtcgaaaatccctacttacttttcaaatttctacacaacatgtagttacatgt |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6388148 |
tgatatatatagatataaacttttcttccttagaaactaaattgaatgtcgaaaatccctacttacttttcaaatttctacacaacatgtagttacatgt |
6388049 |
T |
|
| Q |
119 |
ccacctggtttgttttggatatctgctcaacagcaccacttgagcctattagtctcctcttcactacttatgacagtgagcttggtttcaaacttcttaa |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6388048 |
ccacctggtttgttttggatatctgctcaacagcaccacttgagcccattagtctcctcttcactacttatgacagtgagcttggtttcaaacttcttaa |
6387949 |
T |
|
| Q |
219 |
catgttgcgattatggcgcctgagacgagtcagttctctgtttgcaaggtttgccagcatgttatatttaatttcatggttctgttttcatcaagtcttc |
318 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
6387948 |
catgttgcgattatggcgcctgagacgagtcagttctctgtttgcaaggtttgccagcatgttatatttaatttcatggttctgttttcatcaattcttc |
6387849 |
T |
|
| Q |
319 |
tatttactagaatatttcagtgctttcttccttacttgcacctttgctt |
367 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6387848 |
tatttactagaatatttcagtgctttcttccttacttgcacctttgctt |
6387800 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University