View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1834_low_8 (Length: 324)
Name: NF1834_low_8
Description: NF1834
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1834_low_8 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 87; Significance: 1e-41; HSPs: 4)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 87; E-Value: 1e-41
Query Start/End: Original strand, 207 - 308
Target Start/End: Complemental strand, 40778530 - 40778428
Alignment:
| Q |
207 |
atattatatgtttggtacacatgataaaaacttgatcgtattattttatcatt-ctagcaaaataagaacttgatattttctatggaacttgaggttatt |
305 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||| |||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40778530 |
atattatatatttggtacacatgataaaaacttgatagtattattttatcattgctagcaaaataagaacttgatattttctatggaacttgaggttatt |
40778431 |
T |
 |
| Q |
306 |
att |
308 |
Q |
| |
|
||| |
|
|
| T |
40778430 |
att |
40778428 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 82; E-Value: 1e-38
Query Start/End: Original strand, 10 - 139
Target Start/End: Complemental strand, 40778720 - 40778591
Alignment:
| Q |
10 |
attatactaaatattttgtttgaggctgatagcttttggaggtccggcttggttgagctgctagcgcacgcccaaggtcgggtctgagtgacatttagag |
109 |
Q |
| |
|
|||| ||| |||||||||||||||||| ||| |||||||||| ||| ||||||||||||||| ||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
40778720 |
attagacttaatattttgtttgaggctcataacttttggaggcccgccttggttgagctgcttgcgcacgcccaaggtcgagtctgagtgacatttagag |
40778621 |
T |
 |
| Q |
110 |
cctgttgggtgcacatgaaaggatagacac |
139 |
Q |
| |
|
||| || |||| ||||||||||||||||| |
|
|
| T |
40778620 |
cctatttggtgtgcatgaaaggatagacac |
40778591 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 43 - 77
Target Start/End: Complemental strand, 13288466 - 13288432
Alignment:
| Q |
43 |
ttttggaggtccggcttggttgagctgctagcgca |
77 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||| |
|
|
| T |
13288466 |
ttttggaggtccggcttggttgagctgcttgcgca |
13288432 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #4
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 38 - 92
Target Start/End: Complemental strand, 40956155 - 40956101
Alignment:
| Q |
38 |
atagcttttggaggtccggcttggttgagctgctagcgcacgcccaaggtcgggt |
92 |
Q |
| |
|
||||||||||||||||| | ||||||||||| || || ||| ||||||||||||| |
|
|
| T |
40956155 |
atagcttttggaggtccagtttggttgagctacttgcacacccccaaggtcgggt |
40956101 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 35; Significance: 0.0000000001; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 38 - 96
Target Start/End: Original strand, 14893638 - 14893696
Alignment:
| Q |
38 |
atagcttttggaggtccggcttggttgagctgctagcgcacgcccaaggtcgggtctga |
96 |
Q |
| |
|
||||||||| |||| ||| ||||||||||||||| || ||| ||||||||||||||||| |
|
|
| T |
14893638 |
atagcttttagaggcccgacttggttgagctgcttgcacacccccaaggtcgggtctga |
14893696 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 35; Significance: 0.0000000001; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 38 - 96
Target Start/End: Original strand, 26329249 - 26329307
Alignment:
| Q |
38 |
atagcttttggaggtccggcttggttgagctgctagcgcacgcccaaggtcgggtctga |
96 |
Q |
| |
|
|||| ||||||||| ||||||||||||||||||| |||||| || ||||||||| |||| |
|
|
| T |
26329249 |
ataggttttggaggcccggcttggttgagctgcttgcgcacccctaaggtcgggcctga |
26329307 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 30; Significance: 0.0000001; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 42 - 91
Target Start/End: Complemental strand, 30738970 - 30738921
Alignment:
| Q |
42 |
cttttggaggtccggcttggttgagctgctagcgcacgcccaaggtcggg |
91 |
Q |
| |
|
|||||||||||| ||||||||||||||||| ||||| |||||| ||||| |
|
|
| T |
30738970 |
cttttggaggtctggcttggttgagctgcttgcgcagccccaagttcggg |
30738921 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University