View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF18350_low_5 (Length: 247)

Name: NF18350_low_5
Description: NF18350
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF18350_low_5
NF18350_low_5
[»] chr8 (1 HSPs)
chr8 (18-234)||(420272-420488)


Alignment Details
Target: chr8 (Bit Score: 213; Significance: 1e-117; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 213; E-Value: 1e-117
Query Start/End: Original strand, 18 - 234
Target Start/End: Complemental strand, 420488 - 420272
Alignment:
18 tcaggctaagcattaccaccgccgccacaaagtttgtgagtttcactcgaaggcagccaccgtcgttgcagctgggttgactcagcggttctgccagcaa 117  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
420488 tcaggctaagcattaccaccgccgccacaaagtttgtgagtttcactcgaaggcagccaccgtcgttgcagctgggttgactcagcggttctgccagcaa 420389  T
118 tgcagcaggttgtgatctttaaatgacatgattacccctttaacaactcaatcattgcttatttttgtgcctcacttgaagggcattttcgtctatttct 217  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||    
420388 tgcagcaggttgtgatctttaaatgacatgattacccctttaacaactcaatcattgcttatttttgtgcctcacttcaagggcattttcgtctatttct 420289  T
218 atttatgtctatacttc 234  Q
    |||||||||||||||||    
420288 atttatgtctatacttc 420272  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University