View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18351_high_1 (Length: 694)
Name: NF18351_high_1
Description: NF18351
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18351_high_1 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 285; Significance: 1e-159; HSPs: 3)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 285; E-Value: 1e-159
Query Start/End: Original strand, 378 - 678
Target Start/End: Original strand, 502756 - 503056
Alignment:
| Q |
378 |
tgtgaatggtaaattatgttttaatgacatgatttaattaatgcactataaggctaagtacatgtgcaaattcatatgacataaaagaaaaacactattt |
477 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
502756 |
tgtgaatggtaaattatgttttaatgaaatgatttaattaatgcactataaggctaagtacatgtgcaaattcatatgacataaaagaaaaatactattt |
502855 |
T |
|
| Q |
478 |
ccaagttccaacagcaacatatatttgatatagatcttgaagccaggcatatagcaagaataagtattttataatcaagtttgaagttaaacaaaaactc |
577 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
502856 |
ccaagttccaacagcaacatatatttgatatagatcttgaagccaagcatatagcaagaataagtattttataatcaagtttgaagttaaacaaaaactc |
502955 |
T |
|
| Q |
578 |
actgcaaaatgataagtacagcacatgtagtgattatttgaagttaaatagacacaatttacttccaaaatgctaaattatttgctcacaacagaaactt |
677 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
502956 |
actgcaaaatgataagtgcagcacatgtagtgattatttgaagttaaatagacacaatttacttccaaaatgctaaattatttgctcacaacagaaactt |
503055 |
T |
|
| Q |
678 |
t |
678 |
Q |
| |
|
| |
|
|
| T |
503056 |
t |
503056 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 193; E-Value: 1e-104
Query Start/End: Original strand, 83 - 287
Target Start/End: Original strand, 502257 - 502461
Alignment:
| Q |
83 |
tattgttattgagtggcagatatgtgacaccattggtaatattagtaaacatggtgaaatcatatgttatatgcttacttgtcaatatacatactgaata |
182 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
502257 |
tattgttattgagtggcagatatgtgacaccattggtaatattagtaaacatggtcaaatcatatgttatatgcttacttgtcaatatacatactgaata |
502356 |
T |
|
| Q |
183 |
ggccataagcatgtatcaagtcatatgttcttgggtaagttgaaaagggctcacacctgcaaacaaaacaatgttgtttacttcattatttctgcttcaa |
282 |
Q |
| |
|
|| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
502357 |
gggcataagcatgtatcaagtcatatgttcttgggtaagttgaaaagggctcacacctgcaaacaaaacaatgttgtttccttcattatttctgcttcaa |
502456 |
T |
|
| Q |
283 |
agggt |
287 |
Q |
| |
|
||||| |
|
|
| T |
502457 |
agggt |
502461 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 41; E-Value: 0.00000000000007
Query Start/End: Original strand, 17 - 61
Target Start/End: Original strand, 502222 - 502266
Alignment:
| Q |
17 |
aatatcagtaatgccacacctgcaacaaacattcatattgttatt |
61 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
502222 |
aatatcagtaatgtcacacctgcaacaaacattcatattgttatt |
502266 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University