View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18351_high_8 (Length: 284)
Name: NF18351_high_8
Description: NF18351
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18351_high_8 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 248; Significance: 1e-138; HSPs: 7)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 248; E-Value: 1e-138
Query Start/End: Original strand, 13 - 276
Target Start/End: Complemental strand, 48043490 - 48043227
Alignment:
| Q |
13 |
atttttcggtttgtaaaacattctaaagcaaacaactgaagctctcaacttctgccatatgaatctatttgaatgttacattgcagactgatatcaaggt |
112 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48043490 |
atttgtcggtttgtaaaacattctaaagcaaacaactgaagctctcaacttctgccatatgaatctatttgaatgttacattgcagactgatatcaaggt |
48043391 |
T |
 |
| Q |
113 |
catcgaagggatgatattggtgtatcatactactagtttttcttttccatatttgactggctttaaatccaatctgatagcctgtgataactaggtttac |
212 |
Q |
| |
|
||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |||||||||||||| |
|
|
| T |
48043390 |
cattgaagggatgatattggtgtatcatactactagtttttcttttccatatttgactggctttaaatccaatctgatagcttgtaataactaggtttac |
48043291 |
T |
 |
| Q |
213 |
caacaaaggtatcaaagagagtattatacttatttacctaccatacaggttcacaatattcttc |
276 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48043290 |
caacaaaggtatcaaagagagtattatacttatttacctaccatacaggttcacaatattcttc |
48043227 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 91; E-Value: 4e-44
Query Start/End: Original strand, 20 - 134
Target Start/End: Complemental strand, 48056701 - 48056587
Alignment:
| Q |
20 |
ggtttgtaaaacattctaaagcaaacaactgaagctctcaacttctgccatatgaatctatttgaatgttacattgcagactgatatcaaggtcatcgaa |
119 |
Q |
| |
|
||||||||||||||||||| ||||| ||||||||||||||||||||||| || || |||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
48056701 |
ggtttgtaaaacattctaacgcaaagaactgaagctctcaacttctgccctaggattctatttgaatgttacattgcagactgatatcaaggtcattgaa |
48056602 |
T |
 |
| Q |
120 |
gggatgatattggtg |
134 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
48056601 |
gggatgatattggtg |
48056587 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 76; E-Value: 3e-35
Query Start/End: Original strand, 26 - 133
Target Start/End: Complemental strand, 48051419 - 48051312
Alignment:
| Q |
26 |
taaaacattctaaagcaaacaactgaagctctcaacttctgccatatgaatctatttgaatgttacattgcagactgatatcaaggtcatcgaagggatg |
125 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||| ||||||||||||| ||||||||||||||||||||||||||||||||||| | |||| |||| |
|
|
| T |
48051419 |
taaaacattctaaagcaaacaattgaagctctcaactcttgccatatgaatcaatttgaatgttacattgcagactgatatcaaggtctttgaagagatg |
48051320 |
T |
 |
| Q |
126 |
atattggt |
133 |
Q |
| |
|
|| ||||| |
|
|
| T |
48051319 |
atgttggt |
48051312 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #4
Raw Score: 61; E-Value: 3e-26
Query Start/End: Original strand, 22 - 125
Target Start/End: Complemental strand, 48037433 - 48037329
Alignment:
| Q |
22 |
tttgtaaaacattctaaagcaaacaactgaagctctcaa-cttctgccatatgaatctatttgaatgttacattgcagactgatatcaaggtcatcgaag |
120 |
Q |
| |
|
|||||||| |||||||||||||| |||| |||||||||| |||||||| | |||||||||||||||||| ||||||||||||||||||| ||||| | || |
|
|
| T |
48037433 |
tttgtaaagcattctaaagcaaagaacttaagctctcaaacttctgccctgtgaatctatttgaatgttgcattgcagactgatatcaatgtcatggtag |
48037334 |
T |
 |
| Q |
121 |
ggatg |
125 |
Q |
| |
|
||||| |
|
|
| T |
48037333 |
ggatg |
48037329 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #5
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 195 - 276
Target Start/End: Complemental strand, 48051209 - 48051132
Alignment:
| Q |
195 |
tgtgataactaggtttaccaacaaaggtatcaaagagagtattatacttatttacctaccatacaggttcacaatattcttc |
276 |
Q |
| |
|
||||||| || ||||||||||||||||||||||||||||||||||||||||| |||||| ||||||||||| ||||||| |
|
|
| T |
48051209 |
tgtgatagcttggtttaccaacaaaggtatcaaagagagtattatacttatt----taccattcaggttcacaacattcttc |
48051132 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #6
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 54 - 112
Target Start/End: Complemental strand, 48045258 - 48045200
Alignment:
| Q |
54 |
ctctcaacttctgccatatgaatctatttgaatgttacattgcagactgatatcaaggt |
112 |
Q |
| |
|
||||||||| ||||| |||||||||||||||||||| ||||||||| |||||||||||| |
|
|
| T |
48045258 |
ctctcaactcctgccctatgaatctatttgaatgttgcattgcagattgatatcaaggt |
48045200 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #7
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 197 - 276
Target Start/End: Complemental strand, 48056532 - 48056456
Alignment:
| Q |
197 |
tgataactaggtttaccaacaaaggtatcaaagagagtattatacttatttacctaccatacaggttcacaatattcttc |
276 |
Q |
| |
|
|||||||| ||||||||| |||||||||||||||||| | |||||| ||| |||||| ||| ||||||||||||||| |
|
|
| T |
48056532 |
tgataacttggtttaccatcaaaggtatcaaagagag---tctacttacttatataccattcagattcacaatattcttc |
48056456 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University