View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18351_low_14 (Length: 235)
Name: NF18351_low_14
Description: NF18351
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18351_low_14 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 107; Significance: 9e-54; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 107; E-Value: 9e-54
Query Start/End: Original strand, 15 - 125
Target Start/End: Original strand, 2060127 - 2060237
Alignment:
| Q |
15 |
atgaatagacaccactttatcatattccataaacaataaaagggaaattatgttcaatcgttttcccaaaaatactctatcatatagtggataacctagc |
114 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
2060127 |
atgaatagacaccactttatcatattccataaacaataaaagggaaattatgttcaatcgttttcccaaaaatactctatcatatagcggataacctagc |
2060226 |
T |
 |
| Q |
115 |
aaatatggtga |
125 |
Q |
| |
|
||||||||||| |
|
|
| T |
2060227 |
aaatatggtga |
2060237 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 154 - 215
Target Start/End: Original strand, 2060245 - 2060303
Alignment:
| Q |
154 |
actgtaccaaacacattagatactagataatttatttatagagatatttgataagttgggtt |
215 |
Q |
| |
|
||||||||||| |||||||||||||||||||||| |||||| || ||||||||||||||| |
|
|
| T |
2060245 |
actgtaccaaaaacattagatactagataatttaattatag---tacttgataagttgggtt |
2060303 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University