View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18352_high_14 (Length: 201)
Name: NF18352_high_14
Description: NF18352
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18352_high_14 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 50; Significance: 8e-20; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 50; E-Value: 8e-20
Query Start/End: Original strand, 127 - 184
Target Start/End: Original strand, 42396780 - 42396837
Alignment:
| Q |
127 |
acagtcattatttttatactctcagtggagaacaactataaatatatgctgcccaaaa |
184 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
42396780 |
acagtcagtatttttatactctcagtggagaacaactataaatatatactgcccaaaa |
42396837 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 35; E-Value: 0.00000000007
Query Start/End: Original strand, 19 - 53
Target Start/End: Original strand, 42396672 - 42396706
Alignment:
| Q |
19 |
atacagaacaattatgatgcatattggtttgattc |
53 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
42396672 |
atacagaacaattatgatgcatattggtttgattc |
42396706 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University