View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18352_low_12 (Length: 317)
Name: NF18352_low_12
Description: NF18352
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18352_low_12 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 104; Significance: 8e-52; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 104; E-Value: 8e-52
Query Start/End: Original strand, 200 - 303
Target Start/End: Complemental strand, 31936515 - 31936412
Alignment:
| Q |
200 |
ttgcctgtccaccaagagtctcagtgatgacacgtttgcccccatcataagtttctgaaacagcaacaccttcatttcttgcaatgtttgtagcagtgtt |
299 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31936515 |
ttgcctgtccaccaagagtctcagtgatgacacgtttgcccccatcataagtttctgaaacagcaacaccttcatttcttgcaatgtttgtagcagtgtt |
31936416 |
T |
|
| Q |
300 |
atgt |
303 |
Q |
| |
|
|||| |
|
|
| T |
31936415 |
atgt |
31936412 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 62; E-Value: 9e-27
Query Start/End: Original strand, 200 - 301
Target Start/End: Complemental strand, 31933541 - 31933440
Alignment:
| Q |
200 |
ttgcctgtccaccaagagtctcagtgatgacacgtttgcccccatcataagtttctgaaacagcaacaccttcatttcttgcaatgtttgtagcagtgtt |
299 |
Q |
| |
|
|||||||||||||||| ||||| ||||| ||||||||||| |||| || | ||||||||||||||||||||||||||||||| || ||||| |||||||| |
|
|
| T |
31933541 |
ttgcctgtccaccaagggtctctgtgataacacgtttgcctccattattaatttctgaaacagcaacaccttcatttcttgctatatttgttgcagtgtt |
31933442 |
T |
|
| Q |
300 |
at |
301 |
Q |
| |
|
|| |
|
|
| T |
31933441 |
at |
31933440 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University