View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18352_low_22 (Length: 209)
Name: NF18352_low_22
Description: NF18352
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18352_low_22 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 151; Significance: 4e-80; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 151; E-Value: 4e-80
Query Start/End: Original strand, 40 - 194
Target Start/End: Complemental strand, 32523929 - 32523775
Alignment:
| Q |
40 |
cttagcatattttggtttcataattctgattcatatgatgcaacccaagattgatttaaactcgatcatctggattttcaaatgaaatatagaactcgcc |
139 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32523929 |
cttagcatattttggtttcatatttctgattcatatgatgcaacccaagattgatttaaactcgatcatctggattttcaaatgaaatatagaactcgcc |
32523830 |
T |
|
| Q |
140 |
tagattgatttaaacccaaacatccgagttttcaaatccgagaaaatcaatactg |
194 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32523829 |
tagattgatttaaacccaaacatccgagttttcaaatccgagaaaatcaatactg |
32523775 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University