View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18353_low_12 (Length: 235)
Name: NF18353_low_12
Description: NF18353
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18353_low_12 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 118; Significance: 2e-60; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 118; E-Value: 2e-60
Query Start/End: Original strand, 17 - 170
Target Start/End: Original strand, 45512377 - 45512530
Alignment:
| Q |
17 |
aaaagagaggcaagcccttctcgatttcaaagcatccattgcaaaagattcaccaaacaagctttcatcatggaaaggcactcaatgttgtcaatgggaa |
116 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||||||| | |||||||||||||||||||||||||||||||||||||| ||||| ||||||||| |
|
|
| T |
45512377 |
aaaagagaggcaagcccttctcaatttcaaagcatccattgcacatgattcaccaaacaagctttcatcatggaaaggcactcactgttgccaatgggaa |
45512476 |
T |
|
| Q |
117 |
ggcattggttgtgacaatgttactggacatgttaccaagcttgatctcatgaat |
170 |
Q |
| |
|
|||||||||||||||||||||||| |||||||| ||| ||||||||||||||| |
|
|
| T |
45512477 |
ggcattggttgtgacaatgttactagacatgttgtcaaacttgatctcatgaat |
45512530 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University