View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18353_low_13 (Length: 226)
Name: NF18353_low_13
Description: NF18353
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18353_low_13 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 108; Significance: 2e-54; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 108; E-Value: 2e-54
Query Start/End: Original strand, 1 - 112
Target Start/End: Complemental strand, 51386157 - 51386046
Alignment:
| Q |
1 |
aattgcaatattttagagaggggtgctttttattaaggatattgaagaaaattcaccgtaatttgaagaaagaaacttttgcaaacttatgcaatctgta |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51386157 |
aattgcaatattttagagaggggtgctttttattaaggatattgaagaaaattcaccataatttgaagaaagaaacttttgcaaacttatgcaatctgta |
51386058 |
T |
 |
| Q |
101 |
catttctgcaat |
112 |
Q |
| |
|
|||||||||||| |
|
|
| T |
51386057 |
catttctgcaat |
51386046 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 65; E-Value: 1e-28
Query Start/End: Original strand, 111 - 175
Target Start/End: Complemental strand, 51386004 - 51385940
Alignment:
| Q |
111 |
atttgtgcctttttgtttcatcatccctcattctctttcaattttattccttatttataatcttc |
175 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51386004 |
atttgtgcctttttgtttcatcatccctcattctctttcaattttattccttatttataatcttc |
51385940 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 80; Significance: 1e-37; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 80; E-Value: 1e-37
Query Start/End: Original strand, 6 - 109
Target Start/End: Complemental strand, 11637246 - 11637144
Alignment:
| Q |
6 |
caatattttagagaggggtgctttttattaaggatattgaagaaaattcaccgtaatttgaagaaagaaacttttgcaaacttatgcaatctgtacattt |
105 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||||| |||||||| |||||||||||||||||||||||||| |||||||| ||||||||| |
|
|
| T |
11637246 |
caatattttagagaggggtgctttctattaaggatattgaagaaa-ttcaccgtcatttgaagaaagaaacttttgcaaacatatgcaatttgtacattt |
11637148 |
T |
 |
| Q |
106 |
ctgc |
109 |
Q |
| |
|
|||| |
|
|
| T |
11637147 |
ctgc |
11637144 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 110 - 150
Target Start/End: Complemental strand, 11637100 - 11637060
Alignment:
| Q |
110 |
aatttgtgcctttttgtttcatcatccctcattctctttca |
150 |
Q |
| |
|
||||||| || |||||||||||||||||||||||||||||| |
|
|
| T |
11637100 |
aatttgtacccttttgtttcatcatccctcattctctttca |
11637060 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 123 - 174
Target Start/End: Complemental strand, 15995823 - 15995774
Alignment:
| Q |
123 |
ttgtttcatcatccctcattctctttcaattttattccttatttataatctt |
174 |
Q |
| |
|
||||||||||||||||||| | |||||||||| ||||||||||||||||| |
|
|
| T |
15995823 |
ttgtttcatcatccctcataat--ttcaattttaatccttatttataatctt |
15995774 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 123 - 174
Target Start/End: Complemental strand, 38951704 - 38951655
Alignment:
| Q |
123 |
ttgtttcatcatccctcattctctttcaattttattccttatttataatctt |
174 |
Q |
| |
|
||||||||||||||||||| | |||||||||| ||||||||||||||||| |
|
|
| T |
38951704 |
ttgtttcatcatccctcataat--ttcaattttaatccttatttataatctt |
38951655 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University