View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18354_low_23 (Length: 234)
Name: NF18354_low_23
Description: NF18354
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18354_low_23 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 153; Significance: 3e-81; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 153; E-Value: 3e-81
Query Start/End: Original strand, 19 - 221
Target Start/End: Original strand, 9416088 - 9416279
Alignment:
| Q |
19 |
aatactttaatgcaattaaatgaattggtcaatgtatgccgcaatatgtaaggtttttgttgtgtttcagatgagaagatgatgaatgaaaaatgaagga |
118 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
9416088 |
aatactttaatgcaattaaatgaattggtcaatgtatgccgcaatatgtaaagtttttgttgtgtttcagatgagaagat-----------aatgaagga |
9416176 |
T |
 |
| Q |
119 |
aaactttccagtttattgttaattttgttaagtccagttaacatcgaggaatagaagttgtgtcgtaaaatattttgaaaaccaaaacatgttgtaatat |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| ||||| |
|
|
| T |
9416177 |
aaactttccagtttattgttaattttgttaagtccagttaacatcgaggaatagaagttgtgtcataaaatattttgaaaaccaaaacatgttgaaatat |
9416276 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University