View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18354_low_24 (Length: 232)
Name: NF18354_low_24
Description: NF18354
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18354_low_24 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 147; Significance: 1e-77; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 147; E-Value: 1e-77
Query Start/End: Original strand, 36 - 221
Target Start/End: Original strand, 15478470 - 15478649
Alignment:
| Q |
36 |
aactgtcattgtgcatgatgttttataggtacttggtatggtgtgtgtctgaatctgatgtattggtatgtgataattggatctatacctagtacaagca |
135 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
15478470 |
aactgtcattgtgcatgatgttttataggtacttggtatggtgtgtgtctgaatctgatgtattggcatgtgataattggatctatacctagtacaagca |
15478569 |
T |
 |
| Q |
136 |
acaatcattaaaacatttgaaataaaaattgaaaatcactcaaagaatcaaatataaatattggcatctaaagtcagcctatgctt |
221 |
Q |
| |
|
| |||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| ||||||| |
|
|
| T |
15478570 |
gcgatcattaaaacatttgaaataaaaattgaaaatcactcaaagaatc------aaatattggcatctaaagtcagcttatgctt |
15478649 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University