View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18355_high_11 (Length: 340)
Name: NF18355_high_11
Description: NF18355
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18355_high_11 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 123; Significance: 4e-63; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 123; E-Value: 4e-63
Query Start/End: Original strand, 149 - 322
Target Start/End: Complemental strand, 48015123 - 48014954
Alignment:
| Q |
149 |
tgtgagtatatatattaaaaaggtcaggcactaacggcccgttgattatatcaccttttcatggtatcatctttaattttggttttgtacttgtagaaag |
248 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| | |
|
|
| T |
48015123 |
tgtgagtatatatattaaaaaggtcaggcactaacggat-gttgattatatcaccttttcatggtatcatctttaattttggttttgtaattgtagaa-g |
48015026 |
T |
 |
| Q |
249 |
acgcagaaaatctctatctatgaaaagtgacgcaggtgtatttatgttctaaattaataatatgatgaattaac |
322 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||| |||||||||||| | ||||||||||||| |
|
|
| T |
48015025 |
acgca--aaatctctatctatgaaaagtgacgcaggtgtatttatattctaaattaatcaaatgatgaattaac |
48014954 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 149 - 200
Target Start/End: Complemental strand, 48013422 - 48013372
Alignment:
| Q |
149 |
tgtgagtatatatattaaaaaggtcaggcactaacggcccgttgattatatc |
200 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||| | |||||||||||| |
|
|
| T |
48013422 |
tgtgagtatatatattaaaaaggtcacgcactaacgg-ctgttgattatatc |
48013372 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 93; Significance: 3e-45; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 93; E-Value: 3e-45
Query Start/End: Original strand, 25 - 137
Target Start/End: Complemental strand, 23171972 - 23171860
Alignment:
| Q |
25 |
gggagaattgaccggagtgcaggtggcttaaacggccttctggaaaacggaaaggtgggagatttaccggagaggtgagacgacgtagtatggaggagaa |
124 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||| |||||| ||||||||| |||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
23171972 |
gggagaattgaccggagtgcaggtgggttaaacgaccttctcgaaaacggagaggtgggagatttaccggagaggtgagacgacgtagtatgaaggagaa |
23171873 |
T |
 |
| Q |
125 |
atggggaagtgaa |
137 |
Q |
| |
|
||||||||||||| |
|
|
| T |
23171872 |
atggggaagtgaa |
23171860 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 69 - 122
Target Start/End: Complemental strand, 23220386 - 23220333
Alignment:
| Q |
69 |
aaacggaaaggtgggagatttaccggagaggtgagacgacgtagtatggaggag |
122 |
Q |
| |
|
|||||| || |||||||||||||| | ||||||| |||||||||||| |||||| |
|
|
| T |
23220386 |
aaacgggaaagtgggagatttacctgcgaggtgaaacgacgtagtattgaggag |
23220333 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University