View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18355_high_14 (Length: 304)
Name: NF18355_high_14
Description: NF18355
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18355_high_14 |
 |  |
|
| [»] chr4 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 263; Significance: 1e-147; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 263; E-Value: 1e-147
Query Start/End: Original strand, 18 - 304
Target Start/End: Original strand, 34096918 - 34097204
Alignment:
| Q |
18 |
aaaatagttcccaagctaaagcatcacacctggtattataaatcagatgctttgtttttatgtgagtcattagtgcgcattattaaagttgagaaatttc |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| ||||||| ||||||||||||||||||||||| |
|
|
| T |
34096918 |
aaaatagttcccaagctaaagcatcacacctggtattataaatcaaatgctttgtttttatgtgagtccttagtgcacattattaaagttgagaaatttc |
34097017 |
T |
 |
| Q |
118 |
agtacttgtcgagctttgataactgttttgttgtagatgttcgaaagggatggtggtatagcccttttatggcataattctttcaattgcaatgttgtag |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
34097018 |
agtacttgtcgagctttgataactgttttgttgtagatgttcgaaagggatggtggtatagcccttttatggtataattctttcaattgcaatgttgtag |
34097117 |
T |
 |
| Q |
218 |
attattcttctaatcacatcaaatactgatgttggtgatgctcgtagaggtatttatcatttcatagggtactacggttatcctagt |
304 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |||||||||||||||||||||||||||| |
|
|
| T |
34097118 |
attattcttctaatcacatcaaatactgatgttggtgatgctcgtagaggtgtttatcgtttcatagggtactacggttatcctagt |
34097204 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University