View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF18355_high_17 (Length: 279)

Name: NF18355_high_17
Description: NF18355
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF18355_high_17
NF18355_high_17
[»] chr4 (2 HSPs)
chr4 (112-279)||(6148119-6148286)
chr4 (14-50)||(6148348-6148384)


Alignment Details
Target: chr4 (Bit Score: 140; Significance: 2e-73; HSPs: 2)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 140; E-Value: 2e-73
Query Start/End: Original strand, 112 - 279
Target Start/End: Complemental strand, 6148286 - 6148119
Alignment:
Q  112 gttctatgaaaatattgataaaatttcaccggttcacgaccgagtcccagttcaattaaacatccgatcaaatatgcttatcaaaccggtaatgggtccg 211  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||    
T  6148286 gttctatgaaaatattgataaaatttcaccggttcacgaccgagtcccagttcaattaaacatccgatcgaatatgcttatcaaaccggtaatgggtccg 6148187  T
Q  212 atttctggttcaattggtcaaaccgatcggctcggtccgaattttaaaccttcgattgtgaggtcttc 279  Q
     ||| |||||||||||||||||||||||||||  |||||||||||||||||  |||||||||||||||    
T  6148186 gtttttggttcaattggtcaaaccgatcggctatgtccgaattttaaacctatgattgtgaggtcttc 6148119  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 14 - 50
Target Start/End: Complemental strand, 6148384 - 6148348
Alignment:
Q  14 gagtcaataatcggactgcaggactgttaacccgatc 50  Q
    ||||||||||||||||||||||| |||||||||||||    
T  6148384 gagtcaataatcggactgcaggattgttaacccgatc 6148348  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University