View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18355_high_23 (Length: 239)
Name: NF18355_high_23
Description: NF18355
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18355_high_23 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 176; Significance: 6e-95; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 176; E-Value: 6e-95
Query Start/End: Original strand, 13 - 220
Target Start/End: Original strand, 27016039 - 27016246
Alignment:
| Q |
13 |
gagatgaatgaacgcaccaactgatcagtatcattctttagtaacatgtttgatgttgttaaatcgccatgaacaagaccaccatcatgtaacttcgcaa |
112 |
Q |
| |
|
|||| |||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27016039 |
gagacgaatgaactcaccaactgatcagtatcattctttagtaacatgtttgatgttgttaaatcgccatgaacaagaccaccatcatgtaacttcgcaa |
27016138 |
T |
 |
| Q |
113 |
ttacatcaccaatttgggatgcaatctttcccaggcgctcttcattgacaccgcatgatccgaattcaagaaatacatctttgaccgaaggtccgtcaac |
212 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||||||| |||||||||||||| ||||||||||||||||| |||||||| ||||| |
|
|
| T |
27016139 |
ttacatcaccaatttgggatgcaatctttcccaagcgctcttcattgacaccacatgatccgaattcgagaaatacatctttgactgaaggtccttcaac |
27016238 |
T |
 |
| Q |
213 |
gaattcaa |
220 |
Q |
| |
|
||||||| |
|
|
| T |
27016239 |
aaattcaa |
27016246 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University