View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18355_high_29 (Length: 211)
Name: NF18355_high_29
Description: NF18355
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18355_high_29 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 169; Significance: 8e-91; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 169; E-Value: 8e-91
Query Start/End: Original strand, 20 - 196
Target Start/End: Complemental strand, 14004218 - 14004042
Alignment:
| Q |
20 |
aaatccccctcgatgttttcatctcaagtatgtctggagttctatcaagtcatcacatctcacagtggcgcaaaacttctcctcattgccataattttga |
119 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14004218 |
aaatccccctcgatgttttcatctcaggtatgtctcgagttctatcaagtcatcacatctcacagtggcgcaaaacttctcctcattgccataattttga |
14004119 |
T |
|
| Q |
120 |
tggagtgcctctaacccgacttagcacgtgattgcccccacttgcagatacacacaaagtgtcctcatagcattttt |
196 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14004118 |
tggagtgcctctaacccgacttagcacgtgattgcccccacttgcagatacacacaaagtgtcctcatagcattttt |
14004042 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University