View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18355_high_7 (Length: 391)
Name: NF18355_high_7
Description: NF18355
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18355_high_7 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 270; Significance: 1e-151; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 270; E-Value: 1e-151
Query Start/End: Original strand, 76 - 381
Target Start/End: Original strand, 11777642 - 11777946
Alignment:
| Q |
76 |
tatatttagtttgttagttgattataggattgtatagatcaagcacaccataatatcgtgtaccatgatcattgtcttagaatctactaacaatatcatc |
175 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |||| ||||||||||||||||||||||||||||||| |
|
|
| T |
11777642 |
tatatttagtttgttagttgattataggattgtatagagcaagcacaccataatatcgtgtacgatgaccattgtcttagaatctactaacaatatcatc |
11777741 |
T |
|
| Q |
176 |
gcctattgcaacatctgaaacaactcaaaaacatcgaatttataatttgtaatgacgaacatggatctgtaagtgggaactaataattttctgcatcaac |
275 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
11777742 |
gcctattgcaacatctgaaacaactcaaaaacat-gaatttataatttgtaatgacgaacatggatatgtaagtgggaactaataattttctgcatcaac |
11777840 |
T |
|
| Q |
276 |
ataaatcttgcaatctggtataaaagatggaaagtggatcaagattcattgtctgtctgtcatgaattgcagcttcctccgccataaatcatgacttgga |
375 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| ||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
11777841 |
ataaatcttgcaatctggtataaaagatggaaagtggatcaagattcattgtgtgtctgtcgtgaattgcagcttcctccgccataaataatgacttgga |
11777940 |
T |
|
| Q |
376 |
cctttg |
381 |
Q |
| |
|
|||||| |
|
|
| T |
11777941 |
cctttg |
11777946 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University