View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18355_low_15 (Length: 309)
Name: NF18355_low_15
Description: NF18355
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18355_low_15 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 242; Significance: 1e-134; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 242; E-Value: 1e-134
Query Start/End: Original strand, 1 - 291
Target Start/End: Complemental strand, 6147964 - 6147678
Alignment:
| Q |
1 |
tattgagtttagtgaaaggcttagctactttggaatagcaactagtttggtgatttacctcacaaaggtaatgcatcaagaccttaaaacagcagttagg |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| ||||||||||||||||| |||||||||||| |
|
|
| T |
6147964 |
tattgagtttagtgaaaggcttagctactttggaatagcaactagcttggtgatttacctcacaaaggttatgcatcaagaccttaagacagcagttagg |
6147865 |
T |
|
| Q |
101 |
aatgtgaactattggtctggagtcaccactttgatgccactttttggaggattcttagctgattcgtacttgggccggtacaccactgtgattgcttcat |
200 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |||||||||||||||||||||| |
|
|
| T |
6147864 |
aatgttaactattggtctggagtcaccactttgatgccactttttggaggattcttagctgattcatacttgggccgttacaccactgtgattgcttcat |
6147765 |
T |
|
| Q |
201 |
gcatcatttatctcatggtaatctcaatcttacctcatcatatagaacattaagtaacactaattgagtttaatatactaactgtttaata |
291 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||| |||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
6147764 |
gcatcatttatctcatggtaatctcaatcttacttcatc----agaacattaagtaacattaattgagtttaatatactaactgtttaata |
6147678 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 79; Significance: 6e-37; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 79; E-Value: 6e-37
Query Start/End: Original strand, 2 - 228
Target Start/End: Complemental strand, 23695334 - 23695108
Alignment:
| Q |
2 |
attgagtttagtgaaaggcttagctactttggaatagcaactagtttggtgatttacctcacaaaggtaatgcatcaagaccttaaaacagcagttagga |
101 |
Q |
| |
|
|||||||||||||| ||| | ||||||||||||||||||||||| || || |||||||||||||||| || |||||||| ||||| ||||||| |||| |
|
|
| T |
23695334 |
attgagtttagtgagaggttgagctactttggaatagcaactagcttagtcctttacctcacaaaggttatccatcaagatcttaagacagcagcaagga |
23695235 |
T |
|
| Q |
102 |
atgtgaactattggtctggagtcaccactttgatgccactttttggaggattcttagctgattcgtacttgggccggtacaccactgtgattgcttcatg |
201 |
Q |
| |
|
|||| || |||||| | || ||||| ||| |||||||||| ||||| |||||| |||||||| | || ||||| || ||| || ||||| |||| ||| | |
|
|
| T |
23695234 |
atgttaattattgggcaggtgtcacaactctgatgccactctttggtggattcatagctgatgcatatttgggtcgttactccgctgtggttgcatcaag |
23695135 |
T |
|
| Q |
202 |
catcatttatctcatggtaatctcaat |
228 |
Q |
| |
|
||| ||||||| ||||||| |||||| |
|
|
| T |
23695134 |
cattgtttatcttatggtaagctcaat |
23695108 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University