View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18355_low_19 (Length: 279)
Name: NF18355_low_19
Description: NF18355
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18355_low_19 |
 |  |
|
| [»] chr4 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 140; Significance: 2e-73; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 140; E-Value: 2e-73
Query Start/End: Original strand, 112 - 279
Target Start/End: Complemental strand, 6148286 - 6148119
Alignment:
| Q |
112 |
gttctatgaaaatattgataaaatttcaccggttcacgaccgagtcccagttcaattaaacatccgatcaaatatgcttatcaaaccggtaatgggtccg |
211 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
6148286 |
gttctatgaaaatattgataaaatttcaccggttcacgaccgagtcccagttcaattaaacatccgatcgaatatgcttatcaaaccggtaatgggtccg |
6148187 |
T |
 |
| Q |
212 |
atttctggttcaattggtcaaaccgatcggctcggtccgaattttaaaccttcgattgtgaggtcttc |
279 |
Q |
| |
|
||| ||||||||||||||||||||||||||| ||||||||||||||||| ||||||||||||||| |
|
|
| T |
6148186 |
gtttttggttcaattggtcaaaccgatcggctatgtccgaattttaaacctatgattgtgaggtcttc |
6148119 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 14 - 50
Target Start/End: Complemental strand, 6148384 - 6148348
Alignment:
| Q |
14 |
gagtcaataatcggactgcaggactgttaacccgatc |
50 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
6148384 |
gagtcaataatcggactgcaggattgttaacccgatc |
6148348 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University