View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18355_low_27 (Length: 234)
Name: NF18355_low_27
Description: NF18355
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18355_low_27 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 201; Significance: 1e-110; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 201; E-Value: 1e-110
Query Start/End: Original strand, 1 - 213
Target Start/End: Original strand, 41845518 - 41845730
Alignment:
| Q |
1 |
tgcttcaaattaagttctatttaaagccttggccaatccgtaatatgaccactttatttgccttaagatatggcggggttatgattaactatctaaaggc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41845518 |
tgcttcaaattaagttctatttaaagccttggtcaatccgtaatatgaccactttatttgccttaagatatggcggggttatgattaactatctaaaggc |
41845617 |
T |
 |
| Q |
101 |
ttttcatgtcaggaataaattgagcatttttggaatttgaccagcaaatatgccccacaggcccacatcatatcattcgcatttactatttgttgcaaaa |
200 |
Q |
| |
|
||||||||||| |||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41845618 |
ttttcatgtcaagaataaattgagcagttttggaatttgaccagcaaatatgccccacaggcccacatcatatcattcgcatttactatttgttgcaaaa |
41845717 |
T |
 |
| Q |
201 |
tgattgaatgaat |
213 |
Q |
| |
|
||||||||||||| |
|
|
| T |
41845718 |
tgattgaatgaat |
41845730 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University