View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18355_low_28 (Length: 228)
Name: NF18355_low_28
Description: NF18355
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18355_low_28 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 57; Significance: 6e-24; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 57; E-Value: 6e-24
Query Start/End: Original strand, 6 - 62
Target Start/End: Original strand, 51106817 - 51106873
Alignment:
| Q |
6 |
acttctaaattcacatataaaattgttgtgatttgttgatggcgtaaaactattaac |
62 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51106817 |
acttctaaattcacatataaaattgttgtgatttgttgatggcgtaaaactattaac |
51106873 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 55; E-Value: 9e-23
Query Start/End: Original strand, 92 - 228
Target Start/End: Original strand, 51108001 - 51108135
Alignment:
| Q |
92 |
ctctttgaacattaaagattgaaattgcagagttacttgattggcatttttgatnnnnnnnnnnnnnnnncagtatacttgacctaatagttaataccnn |
191 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| ||||||||| |
|
|
| T |
51108001 |
ctctttgaacattaaagattgaaattgcagagttacttgattggcatttttgat--aaaaaagaaaaaaacagtatacttgacctaatggttaataccaa |
51108098 |
T |
|
| Q |
192 |
nnnnnttaaaagatttgaattgatggtctagatatat |
228 |
Q |
| |
|
|||||||| ||||||||||||||||||||||| |
|
|
| T |
51108099 |
aaaaattaaaagacttgaattgatggtctagatatat |
51108135 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University