View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18356_high_23 (Length: 227)
Name: NF18356_high_23
Description: NF18356
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18356_high_23 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 117; Significance: 9e-60; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 117; E-Value: 9e-60
Query Start/End: Original strand, 17 - 153
Target Start/End: Complemental strand, 8411137 - 8411001
Alignment:
| Q |
17 |
agaaactagtgtactggcaggatatgttattaaccttgagaaagagttgtctactagcatttctgttggagcagctcttgtgcaatcaacacagtttgaa |
116 |
Q |
| |
|
||||||||||||||||| |||| ||||||||||||||||||||||||| ||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8411137 |
agaaactagtgtactggtaggagatgttattaaccttgagaaagagttatctactagcatttatgttggagcagctcttgtgcaatcaacacagtttgaa |
8411038 |
T |
 |
| Q |
117 |
gatgttcatacctcgacgactgaggaacaaagagaaa |
153 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||| |
|
|
| T |
8411037 |
gatgttcatacctcgacgaccgaggaacaaagagaaa |
8411001 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 176 - 211
Target Start/End: Complemental strand, 8411014 - 8410979
Alignment:
| Q |
176 |
ggaacaaagagaaaaccaacaaagtagtaaatttct |
211 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||| |
|
|
| T |
8411014 |
ggaacaaagagaaatccaacaaagtagtaaatttct |
8410979 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 52; Significance: 6e-21; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 52; E-Value: 6e-21
Query Start/End: Original strand, 17 - 124
Target Start/End: Original strand, 20424799 - 20424906
Alignment:
| Q |
17 |
agaaactagtgtactggcaggatatgttattaaccttgagaaagagttgtctactagcatttctgttggagcagctcttgtgcaatcaacacagtttgaa |
116 |
Q |
| |
|
||||||||||| |||| | || || |||||||| ||||| ||||||||||| ||||||| ||||||||| |||||| | |||||||||||||| ||||| |
|
|
| T |
20424799 |
agaaactagtgcactgataagaaatattattaactttgaggaagagttgtctgctagcatctctgttggaacagctcgtttgcaatcaacacagattgaa |
20424898 |
T |
 |
| Q |
117 |
gatgttca |
124 |
Q |
| |
|
|||||||| |
|
|
| T |
20424899 |
gatgttca |
20424906 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University