View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18356_high_26 (Length: 204)
Name: NF18356_high_26
Description: NF18356
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18356_high_26 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 45; Significance: 8e-17; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 45; E-Value: 8e-17
Query Start/End: Original strand, 134 - 187
Target Start/End: Complemental strand, 33393430 - 33393375
Alignment:
| Q |
134 |
ctatcagagcaatgctatat--gtcccgaattattcttcgggaaatatcacgagcg |
187 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
33393430 |
ctatcagagcaatgctatatatgtcccgaattattcttcgggaaatatcacgagcg |
33393375 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 32; E-Value: 0.000000004
Query Start/End: Original strand, 8 - 57
Target Start/End: Complemental strand, 33393553 - 33393507
Alignment:
| Q |
8 |
catcatcacgtggttccgtttttgttatgtttaattatagtgttttgttg |
57 |
Q |
| |
|
||||||||||||||| ||||||| |||||||||||||||||||||||| |
|
|
| T |
33393553 |
catcatcacgtggtttcgttttt---atgtttaattatagtgttttgttg |
33393507 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University