View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18356_low_11 (Length: 307)
Name: NF18356_low_11
Description: NF18356
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18356_low_11 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 126; Significance: 5e-65; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 126; E-Value: 5e-65
Query Start/End: Original strand, 18 - 171
Target Start/End: Original strand, 13590720 - 13590880
Alignment:
| Q |
18 |
gttaatgatgaggttgttttgttgcggattattaagtttaattgttgtaattttctgaaattgttgatcttttgagatgattcgattcagttatt---tg |
114 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
13590720 |
gttaatgatgaggttgttttgttgcggattattaagtttaattgttgtaattttctgaaattgttgatcttttgagatgattcgattcagttattatttg |
13590819 |
T |
 |
| Q |
115 |
tcttcaataa----tcctatgtaacaatgaatggaataaataaattttatgtggttcatca |
171 |
Q |
| |
|
|||||||| | ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13590820 |
tcttcaattaatagtcctatgtaacaatgaatggaataaataaattttatgtggttcatca |
13590880 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 235 - 293
Target Start/End: Original strand, 13590944 - 13591002
Alignment:
| Q |
235 |
cctaagttgagtacaagatttggacaaaatataataaaatagaggaatatcacaggttc |
293 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
13590944 |
cctaagttgaatacaagatttggacaaaatataataaaatagaggaatatcacatgttc |
13591002 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University