View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18356_low_17 (Length: 245)
Name: NF18356_low_17
Description: NF18356
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18356_low_17 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 210; Significance: 1e-115; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 210; E-Value: 1e-115
Query Start/End: Original strand, 18 - 235
Target Start/End: Complemental strand, 2426051 - 2425834
Alignment:
| Q |
18 |
atcttcgacttctaccataattccaataccctttatggcaattggactctgacacctctgctttctctaactcaaggcttgaaaaacacagtaacaacca |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2426051 |
atcttcgacttctaccataattccaataccctttatggcaattggactctgacacctctgctttctctaactcaaggcttgaaaaacacagtaacaacca |
2425952 |
T |
|
| Q |
118 |
gaacagcttgcgtgtattgtagtgtttttgttaattttcaatggcagtggagtataggtgttgtgaaacagagtttttcataagaattatgataattgtt |
217 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2425951 |
gaacagcttgcgtgtactgtagtgtttttgttaattttcaatggcagtggagtataggtgttgtgaaacagagtttttcataagaattatgataattgtt |
2425852 |
T |
|
| Q |
218 |
cttcttgttgtctgtgct |
235 |
Q |
| |
|
||||||||||||| |||| |
|
|
| T |
2425851 |
cttcttgttgtctttgct |
2425834 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University