View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18356_low_19 (Length: 237)
Name: NF18356_low_19
Description: NF18356
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18356_low_19 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 161; Significance: 5e-86; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 161; E-Value: 5e-86
Query Start/End: Original strand, 53 - 221
Target Start/End: Original strand, 10309571 - 10309739
Alignment:
| Q |
53 |
cagagtaaatagaaataacactaactatcacaaaggatatactaacaatagtgttttagcaatgaaaaatattttgagtaagctagctgcacagcactcg |
152 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10309571 |
cagagtaaatagaaataacactaactatcacacaggatatactaacaatagtgttttagcaatgaaaaatattttgagtaagctagctgcacagcactcg |
10309670 |
T |
|
| Q |
153 |
gtatgaactatgttttctcggttgcataccctgggttaatatattgtgccgacaaatttatagtataat |
221 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10309671 |
gtatgaactatgttttctcggttgcatacactgggttaatatattgtgccgacaaatttatagtataat |
10309739 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University