View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF18356_low_26 (Length: 204)

Name: NF18356_low_26
Description: NF18356
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF18356_low_26
NF18356_low_26
[»] chr6 (2 HSPs)
chr6 (134-187)||(33393375-33393430)
chr6 (8-57)||(33393507-33393553)


Alignment Details
Target: chr6 (Bit Score: 45; Significance: 8e-17; HSPs: 2)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 45; E-Value: 8e-17
Query Start/End: Original strand, 134 - 187
Target Start/End: Complemental strand, 33393430 - 33393375
Alignment:
134 ctatcagagcaatgctatat--gtcccgaattattcttcgggaaatatcacgagcg 187  Q
    ||||||||||||||||||||  ||||||||||||||||||||||||||||||||||    
33393430 ctatcagagcaatgctatatatgtcccgaattattcttcgggaaatatcacgagcg 33393375  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #2
Raw Score: 32; E-Value: 0.000000004
Query Start/End: Original strand, 8 - 57
Target Start/End: Complemental strand, 33393553 - 33393507
Alignment:
8 catcatcacgtggttccgtttttgttatgtttaattatagtgttttgttg 57  Q
    ||||||||||||||| |||||||   ||||||||||||||||||||||||    
33393553 catcatcacgtggtttcgttttt---atgtttaattatagtgttttgttg 33393507  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University