View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18357_high_10 (Length: 256)
Name: NF18357_high_10
Description: NF18357
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18357_high_10 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 205; Significance: 1e-112; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 205; E-Value: 1e-112
Query Start/End: Original strand, 13 - 242
Target Start/End: Complemental strand, 30652779 - 30652546
Alignment:
| Q |
13 |
aatatctcaacaaaaagagtagatctgtgttgtgagttgtgattaaacaaaaggatatgaaacgtgatggagaaattttagaagtggtgctgggtggaaa |
112 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30652779 |
aatatctcaacaaaaagagtagagctgtgttgtgaggtgtgattaaacaaaaggatatgaaacgtgatggagaaattttagaagtggtgctgggtggaaa |
30652680 |
T |
 |
| Q |
113 |
acaatcaaagggctcctagtctctttagcaaaacggttatcaaacacataatgcacaaaatggctaaaaagaaggaaacaaatgacaaccacgtt----c |
208 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
30652679 |
acaatcaaagggcttctagtctctttagcaaaacggttatcaaacacataatgcacaaaatggctaaaaagaaggaaacaaatgacaaccacgttcatac |
30652580 |
T |
 |
| Q |
209 |
atatattatatatgcaccactatcacatatatat |
242 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
30652579 |
atatattatatatgcaccactatcacatatatat |
30652546 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University