View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18359_high_32 (Length: 249)
Name: NF18359_high_32
Description: NF18359
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18359_high_32 |
 | |
|
| [»] chr1 (2 HSPs) |
| |
|
Alignment Details
Target: chr1 (Bit Score: 175; Significance: 2e-94; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 175; E-Value: 2e-94
Query Start/End: Original strand, 67 - 249
Target Start/End: Complemental strand, 2095173 - 2094991
Alignment:
| Q |
67 |
atatatatatgatgctacaagaacaatcatacgtatatgcgttagaattattgtgtctttagcatataaataatcacatatgataattataaggaatgat |
166 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2095173 |
atatatatatgatgctacaagaacaatcatacgtatatgcattagaattattgtgtctttagcatataaataatcacatatgataattataaggaatgat |
2095074 |
T |
|
| Q |
167 |
gagaagaatttcactatattatagtcttaaggagcttccctttctaaaattcatttttgcatcatcaacgttattgtattttt |
249 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
2095073 |
gagaagaatttcactatattatagtcttaaggagcttccctttctaaaattgatttttgcatcatcaacgttattgtattttt |
2094991 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 24 - 76
Target Start/End: Complemental strand, 2095280 - 2095228
Alignment:
| Q |
24 |
attacactagaggcatttttaggtgtttgattgatgtatatgaatatatatat |
76 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
2095280 |
attacactagaggcatttttaggtgtttgattgatgtatatgtatatatatat |
2095228 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University