View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18359_high_37 (Length: 211)
Name: NF18359_high_37
Description: NF18359
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18359_high_37 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 121; Significance: 4e-62; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 121; E-Value: 4e-62
Query Start/End: Original strand, 61 - 193
Target Start/End: Original strand, 51426270 - 51426402
Alignment:
| Q |
61 |
tcatctaacgatctaaccatccttgatcaccacttcatccacctttgactaccactattaccaccatcagtcagcactctgactattgtcaaccattgcc |
160 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51426270 |
tcatctaacgatctaaccattcttgatcaccacttcatcaacctttgactaccactattaccaccatcagtcagcactctgactattgtcaaccattgcc |
51426369 |
T |
 |
| Q |
161 |
agccaccactttgattatcatcaatcactaaga |
193 |
Q |
| |
|
|||||||||||||||||||||| |||||||||| |
|
|
| T |
51426370 |
agccaccactttgattatcatcgatcactaaga |
51426402 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University