View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18359_low_27 (Length: 291)
Name: NF18359_low_27
Description: NF18359
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18359_low_27 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 236; Significance: 1e-130; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 236; E-Value: 1e-130
Query Start/End: Original strand, 1 - 280
Target Start/End: Original strand, 2094888 - 2095164
Alignment:
| Q |
1 |
aaaatgtgcactattcctgaatttagttcgtgcatgctcaattttaagtttatagctctcttttttcatcaaaaaggtaatatttatggttaaatataag |
100 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2094888 |
aaaatgtgcactattcctgaatttagttagtgcatgctcaattttaagtttatagctctcttttttcatcaaaaaggtaatatttatggttaaatataag |
2094987 |
T |
|
| Q |
101 |
tttatgtatacagttttcaaaattactctcactttatttaaaaaagctcaaccaatgaattggtaatttgaagtaagtgtcccttacacacagtgattgt |
200 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
2094988 |
tttatgtaaacagttttcaaaattactctcactttatttaaaaaagctcaaccaatgaattggtaatttg----aagtgtcccttacacacagtgattgt |
2095083 |
T |
|
| Q |
201 |
ggtctagtttgttttgatgaaac-gtatttttctaatttcaaatcatataatggagggtaaactttgagtttgttttgatg |
280 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||| ||||||||||||||||||||||| ||||||| |
|
|
| T |
2095084 |
ggtctagtttgttttgatgaaacattatttttctaatttcaaatcatatgatggagggtaaactttgagtttgctttgatg |
2095164 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University