View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18359_low_28 (Length: 280)
Name: NF18359_low_28
Description: NF18359
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18359_low_28 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 229; Significance: 1e-126; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 229; E-Value: 1e-126
Query Start/End: Original strand, 29 - 265
Target Start/End: Original strand, 53525490 - 53525726
Alignment:
| Q |
29 |
cggcgataccggcagagacaagggttttaccgacggcggtgttggagccccatatggtgtatatagggtgagataaggggagttcgagtggttgggaggt |
128 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53525490 |
cggcgataccggcagagacaagggttttaccgacggcggtgttggagccccatatggtgtatatagggtgagataaggggagttcgagtggttgggaggt |
53525589 |
T |
|
| Q |
129 |
ggttgaggataatttgcggcggtggaggtggcgagagagaatgacggtgggaaaacgatacattttgcggctaagtggaagagatcactgaactgtcagt |
228 |
Q |
| |
|
||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53525590 |
ggtggaggataatttgcggcggtggaggtggcgagagagaatgacggtgggaaaacgatacattttgcggctaagtggaagagatcactgaactgtcagt |
53525689 |
T |
|
| Q |
229 |
gttagtgtgaagaaggtcttccttagtcacagatgat |
265 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||| |
|
|
| T |
53525690 |
gttagtgtgaagaaggtcttccttagtcacaggtgat |
53525726 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University