View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18359_low_37 (Length: 238)
Name: NF18359_low_37
Description: NF18359
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18359_low_37 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 127; Significance: 1e-65; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 127; E-Value: 1e-65
Query Start/End: Original strand, 1 - 223
Target Start/End: Original strand, 8496666 - 8496891
Alignment:
| Q |
1 |
aaaggctgagaaaccatttatttcccttgatgtttttggttccaccttgtcttttgtggcacatttaggaaaccaggtacnnnnnnnnnnnnnnn---aa |
97 |
Q |
| |
|
||||||||||||||||||| || | ||||| | |||||||||||||||||| |||||||||||||||||||||||||| || |
|
|
| T |
8496666 |
aaaggctgagaaaccatttgttacacttgactctgttggttccaccttgtcttctgtggcacatttaggaaaccaggtacttttttttttttttttttaa |
8496765 |
T |
 |
| Q |
98 |
ttattaatgcttgggatggaaaagttttttatatctaaaacaagcttaattgctcactagtcctgctcttttcttatgtatttttctcagcaggacaatt |
197 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
8496766 |
ttattaatgcttgggatggaaaagtttttaatatctaaaacaagcttaattgctcactagtcctgttcttttcttatgtatttttctcagcaggacaatt |
8496865 |
T |
 |
| Q |
198 |
gcacaaataagaactatgttcaaatt |
223 |
Q |
| |
|
|||||||||||||||||||||||||| |
|
|
| T |
8496866 |
gcacaaataagaactatgttcaaatt |
8496891 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University