View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18360_high_10 (Length: 312)
Name: NF18360_high_10
Description: NF18360
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18360_high_10 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 93; Significance: 3e-45; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 93; E-Value: 3e-45
Query Start/End: Original strand, 11 - 134
Target Start/End: Complemental strand, 35159863 - 35159737
Alignment:
| Q |
11 |
cataggttgtcacatgttccgtcataagacacatcaccaccaccggacaaagttgatatgagatttggtgg---tggttcttctcataaaccactaccgc |
107 |
Q |
| |
|
||||| ||||||||||||||| ||||||||||||||||||||| ||||||||||||||||||||||||||| |||||||||| |||||||||| |||| |
|
|
| T |
35159863 |
catagattgtcacatgttccgccataagacacatcaccaccacgggacaaagttgatatgagatttggtggtggtggttcttctgataaaccactgccgc |
35159764 |
T |
 |
| Q |
108 |
tgaatttgatattgattgcataagtaa |
134 |
Q |
| |
|
||||||||||||||||||||||||||| |
|
|
| T |
35159763 |
tgaatttgatattgattgcataagtaa |
35159737 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 81; E-Value: 4e-38
Query Start/End: Original strand, 208 - 312
Target Start/End: Complemental strand, 35159663 - 35159559
Alignment:
| Q |
208 |
aagcacctgagaaaccatgtctcaaatgcatcaaccatcaaactcaataaaccatcacagtaaactatattgttttgggatttagtacatgcttcgagtt |
307 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||||||||||||||||||||| | ||| |||||||||||||||| |||||||||||||||||| |
|
|
| T |
35159663 |
aagcacgtgagaaaccatgtctcaaatgcatcaaccatcaaactcaataaaccatcaaaataacatatattgttttgggatgtagtacatgcttcgagtt |
35159564 |
T |
 |
| Q |
308 |
tttct |
312 |
Q |
| |
|
||||| |
|
|
| T |
35159563 |
tttct |
35159559 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University