View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18360_high_16 (Length: 212)
Name: NF18360_high_16
Description: NF18360
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18360_high_16 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 132; Significance: 1e-68; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 132; E-Value: 1e-68
Query Start/End: Original strand, 18 - 197
Target Start/End: Complemental strand, 36611111 - 36610921
Alignment:
| Q |
18 |
aagaaattcgtctaagttttagctttcatagtaaaaatattgaaacacaatttatatct--cttcaa---------cctcaattttaatcgaatcaattt |
106 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| | | | | |||| |||||||||||||||||||||||| |
|
|
| T |
36611111 |
aagaaattcgtctaagttttagctttcatagtaaaaatattgaaacacaattttttttttccgtcaaaaaaaaaaacctcaattttaatcgaatcaattt |
36611012 |
T |
|
| Q |
107 |
aattcaaaaccatcaaaatcatgcgtatcattagcttgttctagcacactttcacaatttgttatgttatttttgtgttgtgctctctctg |
197 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36611011 |
aattcaaaaccatcaaaatcatgcgtatcattagcttgttctagcacactttcacaatttgttatgttatttttgtgttgtgctctctctg |
36610921 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University