View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18361_high_18 (Length: 323)
Name: NF18361_high_18
Description: NF18361
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18361_high_18 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 281; Significance: 1e-157; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 281; E-Value: 1e-157
Query Start/End: Original strand, 19 - 311
Target Start/End: Original strand, 33969063 - 33969355
Alignment:
| Q |
19 |
tgattcgctacggcggcgagacgaagaggagaagcctaaagacctaccgccggcattgccagcaaggccaacgtcgagaggccggttgccgccggcgagg |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33969063 |
tgattcgctacggcggcgagacgaagaggagaagcctaaagacctaccgccggcattgccagcaaggccaacgtcgagaggccggttgccgccggcgagg |
33969162 |
T |
 |
| Q |
119 |
aggtctttgcctaaaagttttaaggttgacggtgaaaatggaaatgaaatggggcatagaaggaagggaagttttggaaataagaagttgatgttggatt |
218 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33969163 |
aggtctttgcctaaaagttttaaggttgatggtgaaaatggaaatgaaatggggcatagaaggaagggaagttttggaaataagaagttgatgttggatt |
33969262 |
T |
 |
| Q |
219 |
tcgaatctccttatgtggttatttcagaagagaacagtgttattagtgaagaagcttcaccttgtcctgtatcttcaattcctgttgatgatg |
311 |
Q |
| |
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
33969263 |
tggaatctccttatgtggttatttcagaagagaacagtgttattagtgaagaagcttcaccttgtcccgtatcttcaattcctgttgatgatg |
33969355 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University