View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18361_high_22 (Length: 281)
Name: NF18361_high_22
Description: NF18361
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18361_high_22 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 147; Significance: 1e-77; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 147; E-Value: 1e-77
Query Start/End: Original strand, 1 - 163
Target Start/End: Original strand, 13946712 - 13946874
Alignment:
| Q |
1 |
tgcaccaccgccccgttctccactaccgggaaagtttatgatgtttccgctgccgcctccatttgtgtttccaccaggcttataccagattccaaatccg |
100 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
13946712 |
tgcaccaccgccccgttttccactaccgggaaagtttatgatgtttccgccgccgcctccatttgtgtttccaccaggcttataccagattccgaatccg |
13946811 |
T |
 |
| Q |
101 |
cttggccatactccataaccatcaactataatatttgtctttgattttcttgtttcaccaact |
163 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13946812 |
cttggccatactccataaccatcagctataatatttgtctttgattttcttgtttcaccaact |
13946874 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 223 - 266
Target Start/End: Original strand, 13946932 - 13946975
Alignment:
| Q |
223 |
atggaaactagttttattttaatatacattgtttcccttctttg |
266 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13946932 |
atggaaactagttttattttaatatacattgtttcccttctttg |
13946975 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University