View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18361_low_27 (Length: 207)
Name: NF18361_low_27
Description: NF18361
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18361_low_27 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 110; Significance: 1e-55; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 110; E-Value: 1e-55
Query Start/End: Original strand, 15 - 128
Target Start/End: Complemental strand, 33555178 - 33555065
Alignment:
| Q |
15 |
agaagaaggaggagctggagaatcattgattggagtttcagaccaaacaagtagatctgcagttgaagtatgtggttttctcaccggtgtgttcctctcc |
114 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
33555178 |
agaagaaggaggagctggagaatcattgattggagtttcagaccaaacaagtagatctgcagttgaagtgtgtggttttctcaccggtgtgttcctctcc |
33555079 |
T |
|
| Q |
115 |
attttcacacgcca |
128 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
33555078 |
attttcacacgcca |
33555065 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 35; E-Value: 0.00000000007
Query Start/End: Original strand, 157 - 191
Target Start/End: Complemental strand, 33555027 - 33554993
Alignment:
| Q |
157 |
tagtgggttttatttttaaagagttttgttgagtg |
191 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
33555027 |
tagtgggttttatttttaaagagttttgttgagtg |
33554993 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University