View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18363_high_14 (Length: 258)
Name: NF18363_high_14
Description: NF18363
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18363_high_14 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 223; Significance: 1e-123; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 223; E-Value: 1e-123
Query Start/End: Original strand, 1 - 243
Target Start/End: Original strand, 12694116 - 12694358
Alignment:
| Q |
1 |
tgagcacgatttcatcagaaaaataatctagggcttaatttcaaatttagaggcaagtagcggatgttaaaattgttaacgagggtgttagccaataaaa |
100 |
Q |
| |
|
|||||||||||||||||||||||||| |||||| |||||||||||||||||||||| || |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12694116 |
tgagcacgatttcatcagaaaaataacctagggtttaatttcaaatttagaggcaaataacggatgttaaaattgttaacgagggtgttagccaataaaa |
12694215 |
T |
 |
| Q |
101 |
ttagttttagggaataagaaattgatttaacatgatcagcagaacaacatccggtgcaatgaagagtgatgacttctagcagtttgatgttctatgtgag |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
12694216 |
ttagttttagggaataagaaattgatttaacatgatcagcagaacaacatccggtgcaatgaagagtgatgacttctagcagtttgatgttctatgcgag |
12694315 |
T |
 |
| Q |
201 |
ggcacatatcatgccgtgggaactttatattgtatgatactcc |
243 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12694316 |
ggcacatatcatgccgtgggaactttatattgtatgatactcc |
12694358 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 160 - 204
Target Start/End: Complemental strand, 42448129 - 42448085
Alignment:
| Q |
160 |
tgaagagtgatgacttctagcagtttgatgttctatgtgagggca |
204 |
Q |
| |
|
|||||||||| ||||| ||||||||||||||||||| ||||||| |
|
|
| T |
42448129 |
tgaagagtgacgactttgagcagtttgatgttctatgcgagggca |
42448085 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University