View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18363_low_15 (Length: 267)
Name: NF18363_low_15
Description: NF18363
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18363_low_15 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 118; Significance: 3e-60; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 118; E-Value: 3e-60
Query Start/End: Original strand, 17 - 138
Target Start/End: Complemental strand, 32507148 - 32507027
Alignment:
| Q |
17 |
gcttacagttgcattcttcatgctcccaaaaggatagcaccctctaaatccatttgaaaatttatttttcaaagaagttgaagagtgaggagatcttgaa |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32507148 |
gcttacagttgcattcttcatgctcccaaaaggatagcaccctctaaatccatttgaaaatttatttttcaaagaagttgaagagtgaggagatcttgaa |
32507049 |
T |
 |
| Q |
117 |
agccttccatctctcgtcgaaa |
138 |
Q |
| |
|
||||||||||||||||| |||| |
|
|
| T |
32507048 |
agccttccatctctcgttgaaa |
32507027 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 71; E-Value: 3e-32
Query Start/End: Original strand, 173 - 261
Target Start/End: Complemental strand, 32506992 - 32506907
Alignment:
| Q |
173 |
tgaagatgaagaaggtgacacattattatgagatttccttgaacctacaagcctaggcaaaatggtaaaaaatatgttgttgacctttg |
261 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
32506992 |
tgaagatgaagaaggtgacacattat---gagatttccttgaacctacaagcctaggcaaaatggtaaaaaatatgttgttgacttttg |
32506907 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University