View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18363_low_18 (Length: 237)
Name: NF18363_low_18
Description: NF18363
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18363_low_18 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 118; Significance: 2e-60; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 118; E-Value: 2e-60
Query Start/End: Original strand, 17 - 134
Target Start/End: Complemental strand, 45825532 - 45825415
Alignment:
| Q |
17 |
aaattcacatgccactacataatcaacttaggaatgtgacaaatttataaataatattgagattattatatttaaagagccgtttctttcaattatatgc |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45825532 |
aaattcacatgccactacataatcaacttaggaatgtgacaaatttataaataatattgagattattatatttaaagagccgtttctttcaattatatgc |
45825433 |
T |
|
| Q |
117 |
atgataaattaaactaag |
134 |
Q |
| |
|
|||||||||||||||||| |
|
|
| T |
45825432 |
atgataaattaaactaag |
45825415 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 196 - 237
Target Start/End: Complemental strand, 45825353 - 45825312
Alignment:
| Q |
196 |
tatagccatactgaaataatatactatcatttatggaaaccc |
237 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45825353 |
tatagccatactgaaataatatactatcatttatggaaaccc |
45825312 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University