View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18363_low_20 (Length: 218)
Name: NF18363_low_20
Description: NF18363
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18363_low_20 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 169; Significance: 8e-91; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 169; E-Value: 8e-91
Query Start/End: Original strand, 17 - 202
Target Start/End: Complemental strand, 26460493 - 26460306
Alignment:
| Q |
17 |
caaaatcatggcgcccgtctttacaaagcatctcagagttttccggttgagtggttgtataccttgtgaaatgt--actaccgtgtctcagaacgttatt |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |||||||||| |
|
|
| T |
26460493 |
caaaatcatggcgcccgtctttacaaagcatctcagagttttccggttgagtggttgtataccttgtgaaatgtgtactaccgtgtctcggaacgttatt |
26460394 |
T |
 |
| Q |
115 |
cattgcctcttgtgtcggatgctcctccaggttgaactcctgatacatgcataggaaaggaagttcaacagaggctcaaattattcat |
202 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
26460393 |
cattgcctcttgtgtcggatgctcctccaggttgaactcctgatacatgcataggaaaggaagttcaatagaggctcaaattattcat |
26460306 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 67; E-Value: 6e-30
Query Start/End: Original strand, 17 - 91
Target Start/End: Complemental strand, 26447854 - 26447780
Alignment:
| Q |
17 |
caaaatcatggcgcccgtctttacaaagcatctcagagttttccggttgagtggttgtataccttgtgaaatgta |
91 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| ||||||||||||| |
|
|
| T |
26447854 |
caaaatcatggcgcccgtctttacaaagcatctcagagttttccggttgagtggtggtataacttgtgaaatgta |
26447780 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University