View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF18364_high_21 (Length: 355)

Name: NF18364_high_21
Description: NF18364
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF18364_high_21
NF18364_high_21
[»] chr5 (2 HSPs)
chr5 (20-253)||(28668382-28668615)
chr5 (260-345)||(28668254-28668339)
[»] chr8 (1 HSPs)
chr8 (37-179)||(17112072-17112213)
[»] chr4 (4 HSPs)
chr4 (35-164)||(17257676-17257805)
chr4 (46-143)||(16176144-16176241)
chr4 (255-320)||(17257484-17257549)
chr4 (35-117)||(36471300-36471382)
[»] chr3 (1 HSPs)
chr3 (35-117)||(23646901-23646983)
[»] chr7 (1 HSPs)
chr7 (38-117)||(3702282-3702360)
[»] chr1 (1 HSPs)
chr1 (35-96)||(14783741-14783802)


Alignment Details
Target: chr5 (Bit Score: 202; Significance: 1e-110; HSPs: 2)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 202; E-Value: 1e-110
Query Start/End: Original strand, 20 - 253
Target Start/End: Complemental strand, 28668615 - 28668382
Alignment:
20 gcataaatagctgccacggacccttcgagcgggtttgatagcctttattctttttccggttgctcttggacacaacattagtatacccctcttcatcatc 119  Q
    ||||||||| |||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
28668615 gcataaataactgccatggacccttcgagcgggtttgatagcctttattctttttccggttgctcttggacacaacattagtatacccctcttcatcatc 28668516  T
120 gacattagtagcaactagggcctgctgtatgatttccaaatctttaataatcaaaggacaccaatgaggaatgaaagttgcaagagggtgttgtttgggc 219  Q
    ||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| ||| ||||||||||||||||||||||||||||||||     
28668515 gacattagtagcaaccagggcctgctgtatgatttccaaatctttaataatcaaaggacaccgatgcggaatgaaagttgcaagagggtgttgtttggga 28668416  T
220 agtttggcagtagcagtgaaccttgccacacctt 253  Q
    ||||||||||||||||||||  ||||||||||||    
28668415 agtttggcagtagcagtgaaggttgccacacctt 28668382  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 70; E-Value: 2e-31
Query Start/End: Original strand, 260 - 345
Target Start/End: Complemental strand, 28668339 - 28668254
Alignment:
260 gctgcgcagggggatgttccatattatcttgttggacatgtaacactggttctaagatggctatgcttgcgacatcagagtgatga 345  Q
    ||||||||||||||||||||| |||||||||||| |||||||| ||||||||||||||||||||||||||||||||||||| ||||    
28668339 gctgcgcagggggatgttccacattatcttgttgaacatgtaatactggttctaagatggctatgcttgcgacatcagagttatga 28668254  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8 (Bit Score: 75; Significance: 2e-34; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 75; E-Value: 2e-34
Query Start/End: Original strand, 37 - 179
Target Start/End: Complemental strand, 17112213 - 17112072
Alignment:
37 ggacccttcgagcgggtttgatagcctttattctttttccggttgctcttggacacaacattagtatacccctcttcatcatcgacattagtagcaacta 136  Q
    |||||||| || ||||||||||||||||||||||||||| |||||||||||||||||||| ||||| ||||||| |||||| |  |||||  | |||| |    
17112213 ggacccttggaacgggtttgatagcctttattctttttc-ggttgctcttggacacaacagtagtaaacccctcctcatcaacatcattataaacaacca 17112115  T
137 gggcctgctgtatgatttccaaatctttaataatcaaaggaca 179  Q
    ||||||| |||||||| |||||||||||| |||||||||||||    
17112114 gggcctgttgtatgatctccaaatctttagtaatcaaaggaca 17112072  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 50; Significance: 1e-19; HSPs: 4)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 35 - 164
Target Start/End: Complemental strand, 17257805 - 17257676
Alignment:
35 acggacccttcgagcgggtttgatagcctttattctttttccggttgctcttggacacaacattagtatacccctcttcatcatcgacattagtagcaac 134  Q
    |||||||| | |||||||||||||||| ||| ||||| || ||| |||||||||| ||||| |||||| |||||||||||||||| ||| ||||| | ||    
17257805 acggacccctggagcgggtttgatagcatttcttcttctttcggctgctcttggaaacaaccttagtaaacccctcttcatcatcaacaatagtaacgac 17257706  T
135 tagggcctgctgtatgatttccaaatcttt 164  Q
    || |||||| || ||  | |||||||||||    
17257705 tacggcctgttgaattgtctccaaatcttt 17257676  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 46 - 143
Target Start/End: Original strand, 16176144 - 16176241
Alignment:
46 gagcgggtttgatagcctttattctttttccggttgctcttggacacaacattagtatacccctcttcatcatcgacattagtagcaactagggcctg 143  Q
    |||||||||||||| | ||||||||| ||||||||||||||||| | |||| | ||||||||||| | |||| | ||||||| | |||| ||||||||    
16176144 gagcgggtttgataacttttattcttcttccggttgctcttggaaataacaatggtatacccctccttatcagccacattagaaacaaccagggcctg 16176241  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #3
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 255 - 320
Target Start/End: Complemental strand, 17257549 - 17257484
Alignment:
255 ctgttgctgcgcagggggatgttccatattatcttgttggacatgtaacactggttctaagatggc 320  Q
    ||||||||||||| ||||| |||||| |||||||| ||| ||||||||||| ||||||||||||||    
17257549 ctgttgctgcgcaaggggaggttccacattatcttattgaacatgtaacaccggttctaagatggc 17257484  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #4
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 35 - 117
Target Start/End: Complemental strand, 36471382 - 36471300
Alignment:
35 acggacccttcgagcgggtttgatagcctttattctttttccggttgctcttggacacaacattagtatacccctcttcatca 117  Q
    |||||||||| |||||||||||||| | ||| | ||| ||| |||||| |||||| ||||||  |||| ||||||| ||||||    
36471382 acggacccttggagcgggtttgataacatttttgcttcttctggttgcgcttggaaacaacagcagtaaacccctcctcatca 36471300  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3 (Bit Score: 47; Significance: 9e-18; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 47; E-Value: 9e-18
Query Start/End: Original strand, 35 - 117
Target Start/End: Complemental strand, 23646983 - 23646901
Alignment:
35 acggacccttcgagcgggtttgatagcctttattctttttccggttgctcttggacacaacattagtatacccctcttcatca 117  Q
    |||||||||| || ||||||||||| ||||| | ||| ||||||||||||||||| |||||||||||| ||||||| ||||||    
23646983 acggacccttggatcgggtttgataacctttttgcttcttccggttgctcttggaaacaacattagtaaacccctcctcatca 23646901  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7 (Bit Score: 36; Significance: 0.00000000003; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 38 - 117
Target Start/End: Original strand, 3702282 - 3702360
Alignment:
38 gacccttcgagcgggtttgatagcctttattctttttccggttgctcttggacacaacattagtatacccctcttcatca 117  Q
    ||||||| || ||||||| |||| |||||| |||||||||||||||||||||| ||||  ||||| ||||||| ||||||    
3702282 gacccttggaacgggttt-atagtctttatcctttttccggttgctcttggacgcaacggtagtaaacccctcctcatca 3702360  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1 (Bit Score: 34; Significance: 0.0000000005; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 35 - 96
Target Start/End: Complemental strand, 14783802 - 14783741
Alignment:
35 acggacccttcgagcgggtttgatagcctttattctttttccggttgctcttggacacaaca 96  Q
    |||||||||| |||||||||| ||| ||||| ||||| ||| ||||||||||||| ||||||    
14783802 acggacccttggagcgggtttaataaccttttttcttattctggttgctcttggaaacaaca 14783741  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University