View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18364_high_30 (Length: 257)
Name: NF18364_high_30
Description: NF18364
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18364_high_30 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 219; Significance: 1e-120; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 219; E-Value: 1e-120
Query Start/End: Original strand, 17 - 239
Target Start/End: Complemental strand, 26959090 - 26958868
Alignment:
| Q |
17 |
gtggtatcaaagtttattctttttgactatgtgatgtttttaagaaatataccattgattgaaatttgtgacaagttttttctattttggtgttgtggaa |
116 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26959090 |
gtggtatcaaagtttattctttttgactatgtgatgtttttaagaaatatatcattgattgaaatttgtgacaagttttttctattttggtgttgtggaa |
26958991 |
T |
 |
| Q |
117 |
ttggttttaggtatgataatgggggcatcagcatcatcagtttggtataatttgagagtggctcatccaacaaaacaagtgccaatattagactatgatt |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26958990 |
ttggttttaggtatgataatgggggcatcagcatcatcagtttggtataatttgagagtggctcatccaacaaaacaagtgccaatattagactatgatt |
26958891 |
T |
 |
| Q |
217 |
tggctcttttgtttcagccaatg |
239 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
26958890 |
tggctcttttgtttcagccaatg |
26958868 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University