View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18364_low_11 (Length: 477)
Name: NF18364_low_11
Description: NF18364
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18364_low_11 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 293; Significance: 1e-164; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 293; E-Value: 1e-164
Query Start/End: Original strand, 103 - 454
Target Start/End: Complemental strand, 56313821 - 56313473
Alignment:
| Q |
103 |
aagctgagacagggaaaatggcgcccccgccgccaccacaagcggagactaacagagagtttcccgcagcagcatattgtactaggtgcctaggttgatg |
202 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||| ||||||||||||||||||||||||||||| | ||||||||||||||||||||||||||| |
|
|
| T |
56313821 |
aagctgagacagggaaaatgacgcccccgccgccacca---gcggagactaacagagagtttcccgcagctgaatattgtactaggtgcctaggttgatg |
56313725 |
T |
 |
| Q |
203 |
ctgctgctgc---atcatcatcaatccttcttcctcttctgaacggtaattagtaggaggaggagtattgctatacttggaaagcccaagagttgttgtg |
299 |
Q |
| |
|
|||||||||| || ||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
56313724 |
ctgctgctgctgcataatcatcaatccttcttcttcttctgaacggtaattagtaggaggaggagtattgctatacttggaaagcccaagagttgttgtg |
56313625 |
T |
 |
| Q |
300 |
acatgatctgaattaccgccgctactgcttccttccattttgttaactatgtgatcatcaattgtctttggtgattgtccaacaacaaatcccattccca |
399 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
56313624 |
acatgatctgaattaccgccgctactgcttccttccattttgttaactatgtgatcatcaattgtctttggtgattgtccaacaacaaatcccattccca |
56313525 |
T |
 |
| Q |
400 |
atattttttcattttgctgcttattcttgtctgaatgtgaagcagtagtacctct |
454 |
Q |
| |
|
||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
56313524 |
ata---tttcattttgctgcttattcttgtctgaatgtgaagcagtagtacctct |
56313473 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 82; E-Value: 2e-38
Query Start/End: Original strand, 4 - 85
Target Start/End: Original strand, 47673084 - 47673165
Alignment:
| Q |
4 |
gccataggggtgaactgtggctccatattgaggatttccaaaaggatttgcagattgttgttgaggggccatcgtcatcatt |
85 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47673084 |
gccataggggtgaactgtggctccatattgaggatttccaaaaggatttgcagattgttgttgaggggccatcgtcatcatt |
47673165 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University