View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18364_low_26 (Length: 355)
Name: NF18364_low_26
Description: NF18364
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18364_low_26 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 202; Significance: 1e-110; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 202; E-Value: 1e-110
Query Start/End: Original strand, 20 - 253
Target Start/End: Complemental strand, 28668615 - 28668382
Alignment:
| Q |
20 |
gcataaatagctgccacggacccttcgagcgggtttgatagcctttattctttttccggttgctcttggacacaacattagtatacccctcttcatcatc |
119 |
Q |
| |
|
||||||||| |||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28668615 |
gcataaataactgccatggacccttcgagcgggtttgatagcctttattctttttccggttgctcttggacacaacattagtatacccctcttcatcatc |
28668516 |
T |
 |
| Q |
120 |
gacattagtagcaactagggcctgctgtatgatttccaaatctttaataatcaaaggacaccaatgaggaatgaaagttgcaagagggtgttgtttgggc |
219 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| ||| |||||||||||||||||||||||||||||||| |
|
|
| T |
28668515 |
gacattagtagcaaccagggcctgctgtatgatttccaaatctttaataatcaaaggacaccgatgcggaatgaaagttgcaagagggtgttgtttggga |
28668416 |
T |
 |
| Q |
220 |
agtttggcagtagcagtgaaccttgccacacctt |
253 |
Q |
| |
|
|||||||||||||||||||| |||||||||||| |
|
|
| T |
28668415 |
agtttggcagtagcagtgaaggttgccacacctt |
28668382 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 70; E-Value: 2e-31
Query Start/End: Original strand, 260 - 345
Target Start/End: Complemental strand, 28668339 - 28668254
Alignment:
| Q |
260 |
gctgcgcagggggatgttccatattatcttgttggacatgtaacactggttctaagatggctatgcttgcgacatcagagtgatga |
345 |
Q |
| |
|
||||||||||||||||||||| |||||||||||| |||||||| ||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
28668339 |
gctgcgcagggggatgttccacattatcttgttgaacatgtaatactggttctaagatggctatgcttgcgacatcagagttatga |
28668254 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 75; Significance: 2e-34; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 75; E-Value: 2e-34
Query Start/End: Original strand, 37 - 179
Target Start/End: Complemental strand, 17112213 - 17112072
Alignment:
| Q |
37 |
ggacccttcgagcgggtttgatagcctttattctttttccggttgctcttggacacaacattagtatacccctcttcatcatcgacattagtagcaacta |
136 |
Q |
| |
|
|||||||| || ||||||||||||||||||||||||||| |||||||||||||||||||| ||||| ||||||| |||||| | ||||| | |||| | |
|
|
| T |
17112213 |
ggacccttggaacgggtttgatagcctttattctttttc-ggttgctcttggacacaacagtagtaaacccctcctcatcaacatcattataaacaacca |
17112115 |
T |
 |
| Q |
137 |
gggcctgctgtatgatttccaaatctttaataatcaaaggaca |
179 |
Q |
| |
|
||||||| |||||||| |||||||||||| ||||||||||||| |
|
|
| T |
17112114 |
gggcctgttgtatgatctccaaatctttagtaatcaaaggaca |
17112072 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 50; Significance: 1e-19; HSPs: 4)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 35 - 164
Target Start/End: Complemental strand, 17257805 - 17257676
Alignment:
| Q |
35 |
acggacccttcgagcgggtttgatagcctttattctttttccggttgctcttggacacaacattagtatacccctcttcatcatcgacattagtagcaac |
134 |
Q |
| |
|
|||||||| | |||||||||||||||| ||| ||||| || ||| |||||||||| ||||| |||||| |||||||||||||||| ||| ||||| | || |
|
|
| T |
17257805 |
acggacccctggagcgggtttgatagcatttcttcttctttcggctgctcttggaaacaaccttagtaaacccctcttcatcatcaacaatagtaacgac |
17257706 |
T |
 |
| Q |
135 |
tagggcctgctgtatgatttccaaatcttt |
164 |
Q |
| |
|
|| |||||| || || | ||||||||||| |
|
|
| T |
17257705 |
tacggcctgttgaattgtctccaaatcttt |
17257676 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 46 - 143
Target Start/End: Original strand, 16176144 - 16176241
Alignment:
| Q |
46 |
gagcgggtttgatagcctttattctttttccggttgctcttggacacaacattagtatacccctcttcatcatcgacattagtagcaactagggcctg |
143 |
Q |
| |
|
|||||||||||||| | ||||||||| ||||||||||||||||| | |||| | ||||||||||| | |||| | ||||||| | |||| |||||||| |
|
|
| T |
16176144 |
gagcgggtttgataacttttattcttcttccggttgctcttggaaataacaatggtatacccctccttatcagccacattagaaacaaccagggcctg |
16176241 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 255 - 320
Target Start/End: Complemental strand, 17257549 - 17257484
Alignment:
| Q |
255 |
ctgttgctgcgcagggggatgttccatattatcttgttggacatgtaacactggttctaagatggc |
320 |
Q |
| |
|
||||||||||||| ||||| |||||| |||||||| ||| ||||||||||| |||||||||||||| |
|
|
| T |
17257549 |
ctgttgctgcgcaaggggaggttccacattatcttattgaacatgtaacaccggttctaagatggc |
17257484 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #4
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 35 - 117
Target Start/End: Complemental strand, 36471382 - 36471300
Alignment:
| Q |
35 |
acggacccttcgagcgggtttgatagcctttattctttttccggttgctcttggacacaacattagtatacccctcttcatca |
117 |
Q |
| |
|
|||||||||| |||||||||||||| | ||| | ||| ||| |||||| |||||| |||||| |||| ||||||| |||||| |
|
|
| T |
36471382 |
acggacccttggagcgggtttgataacatttttgcttcttctggttgcgcttggaaacaacagcagtaaacccctcctcatca |
36471300 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 47; Significance: 9e-18; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 47; E-Value: 9e-18
Query Start/End: Original strand, 35 - 117
Target Start/End: Complemental strand, 23646983 - 23646901
Alignment:
| Q |
35 |
acggacccttcgagcgggtttgatagcctttattctttttccggttgctcttggacacaacattagtatacccctcttcatca |
117 |
Q |
| |
|
|||||||||| || ||||||||||| ||||| | ||| ||||||||||||||||| |||||||||||| ||||||| |||||| |
|
|
| T |
23646983 |
acggacccttggatcgggtttgataacctttttgcttcttccggttgctcttggaaacaacattagtaaacccctcctcatca |
23646901 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 36; Significance: 0.00000000003; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 38 - 117
Target Start/End: Original strand, 3702282 - 3702360
Alignment:
| Q |
38 |
gacccttcgagcgggtttgatagcctttattctttttccggttgctcttggacacaacattagtatacccctcttcatca |
117 |
Q |
| |
|
||||||| || ||||||| |||| |||||| |||||||||||||||||||||| |||| ||||| ||||||| |||||| |
|
|
| T |
3702282 |
gacccttggaacgggttt-atagtctttatcctttttccggttgctcttggacgcaacggtagtaaacccctcctcatca |
3702360 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 34; Significance: 0.0000000005; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 35 - 96
Target Start/End: Complemental strand, 14783802 - 14783741
Alignment:
| Q |
35 |
acggacccttcgagcgggtttgatagcctttattctttttccggttgctcttggacacaaca |
96 |
Q |
| |
|
|||||||||| |||||||||| ||| ||||| ||||| ||| ||||||||||||| |||||| |
|
|
| T |
14783802 |
acggacccttggagcgggtttaataaccttttttcttattctggttgctcttggaaacaaca |
14783741 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University