View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18364_low_30 (Length: 289)
Name: NF18364_low_30
Description: NF18364
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18364_low_30 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 237; Significance: 1e-131; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 237; E-Value: 1e-131
Query Start/End: Original strand, 24 - 276
Target Start/End: Original strand, 4866885 - 4867137
Alignment:
| Q |
24 |
aacctacaattagcactatacaggtactaatgttaacattcaatgacttctcactatctgtttctttaatattcgttgcattcagggcatcaagaatgac |
123 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4866885 |
aacctacaattagcactatacaggtactaatgttaacattcaatgacttctcactatctgtttctttaatattcgttgcattcagggcatcaagaatgac |
4866984 |
T |
|
| Q |
124 |
ttacttggattttggattcaacttgccaaggagaacgagcatgtccaagctagaaatacaagtaccatctgcacttcattgactgaaaattcatcacaaa |
223 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4866985 |
ttacttggattggggattcaacttgccaaggagaacaagcatgtccaagctagaaatacaagtaccatctgcacttcattgactgaaaattcatcacaaa |
4867084 |
T |
|
| Q |
224 |
agaatattgatggatcccaatttgtaaaacagaacatcacaataatgtttttg |
276 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
4867085 |
agaatattgatggatcccaatttgtaaaacagaacgtcacaataatgtttttg |
4867137 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University